Offspring were genotyped for the intron 2 lox insertion using PCR (forward primer 5’ AGAGAAGTCTACGCTGTAGTCAG 3’ and reverse primer 5’ AAGCGGGAAGGTAGAGAGGT 3’; wild type product ... from Cell Signaling ...

Regarding food, the Siberian tiger usually goes after hoofed animals such as deer, wild boar, elk, and wild goats but will also eat small mammals ... caused by expanding agricultural land; and ...

Wildlife campaigners in Scotland are calling for wild goats to be legally protected after land owners began culling 118 goats from an ancient herd. The wild goats of Langholm Fell have roamed the ...

Ticks are more likely to carry the bacteria that can cause Lyme disease in areas where pheasants are released, new research ...

On a humid January morning in 2023, deep in the heart of Côte d’Ivoire’s Taï National Park, a baby monkey fell ill. Its skin ...

Disease, drought and predators like mountain lions have all been blamed for the herd’s demise. Unfortunately, large die-offs ...

New insights into the mechanisms that cause more severe cases of schistosomiasis -- a disease caused by parasitic worms and second only to malaria in terms of potential harm -- have been revealed.

Viral diseases in domestic ruminants such as cattle, goats, and sheep represent a major threat to livestock industries worldwide, leading to significant ...

Former NBA player and two-time NBA All-Star Victor Oladipo has made an interesting argument for someone other than Michael Jordan or LeBron James being considered in the GOAT debate, especially ...

A campaign has been launched to protect an ancient herd of wild goats on a moor in the south of Scotland amid an outcry about a cull. The goats roam across Langholm Moor including 11,000 acres ...