News
Hosted on MSN19d
500,000 cattle vaccinated against foot-and-mouth since JanuaryMore than 500,000 cattle have been vaccinated against foot-and-mouth disease ... Petits Ruminants (PPR) vaccine, primarily in counties with large populations of sheep and goats.Counties with ...
Offspring were genotyped for the intron 2 lox insertion using PCR (forward primer 5’ AGAGAAGTCTACGCTGTAGTCAG 3’ and reverse primer 5’ AAGCGGGAAGGTAGAGAGGT 3’; wild type product ... from Cell Signaling ...
At least 50 hippos and other large animals have been killed by anthrax poisoning in eastern Congo's Virunga National Park and ...
About 50 hippos have died of anthrax poisoning in the Democratic Republic of Congo's Virunga National Park, the oldest ...
INDIANAPOLIS — The Indiana Department of Natural Resources (IDNR) has confirmed two cases of chronic wasting disease (CWD) in wild deer – one in LaGrange County and the other in Posey County.
A campaign has been launched to protect an ancient herd of wild goats on a moor in the south of Scotland amid an outcry about a cull. The goats roam across Langholm Moor including 11,000 acres ...
A campaign has been launched to protect an ancient herd of wild goats on a moor in the south of Scotland amid an outcry about a cull. The goats roam across Langholm Moor including 11,000 acres (4,450 ...
Heart disease has long been the leading killer of adults, but beyond that stark fact, men and women diverge. From differences at the cellular level of the heart to circulatory structure to ...
Some results have been hidden because they may be inaccessible to you
Show inaccessible results